circad | circRNAs associated with diseases

circ-PRKCI
Gene	PRKCI	Organism	Human
Genome Locus		Build	hg19
Disease	Hirschsprung Disease	ICD-10	Hirschsprung disease (Q43.1)
DBLink		PMID	29895226
Experimental Method
Sample Type	Tissue and cell lines	Comparison	48 patients with HSCR and 48 matched controls
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward TAGCAGTTCCCCAATCCTTG Reverse CACAAATTCCCATCATTCCC	Statistics	Fold Change : Downregulated pvalue : <0.05
Citation
Zhou, L, Li, Y, Jiang, W, Zhang, H, Wen, Z, Su, Y, Wu, F, Zhi, Z, Shen, Q, Li, H, Xu, X, Tang, W (2018). Down-regulation of circ-PRKCI inhibits cell migration and proliferation in Hirschsprung disease by suppressing the expression of miR-1324 target PLCB1. Cell Cycle, 17, 9:1092-1101.